cpaA [2019-05-08 09:46:43]

K⁺/H⁺ antiporter

locus: BSU11640

pI: 5.25

mw: 67.29 kDa

protein length: 614 aa

gene length: 1845 bp

function: export of potassium ions

product: K⁺/H⁺ antiporter

essential: no

synonyms: yjbQ

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.3|Potassium uptake/ export]
• [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.1|Targets of c-di-AMP]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 1,240,356 1,242,200

The protein

Protein family

• Monovalent cation:proton antiporter 2 (CPA2) transporter (TC 2.A.37) family (with [protein|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|CpaA], according to UniProt)

[SW|Domains]

• contains a [SW|RCK_N domain] (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
• contains a [SW|RCK_C domain] at the C-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt])

Structure

• [PDB|4BWZ] (from Thermus thermophilus, corresponds to the transmembrane domain (aa 27 ... 402), 26% identity) [pubmed|23995679]
• [PDB|4YS2] (S. aureus CpaA, the [SW|RCK_C domain] in complex with c-di-AMP, 58% identity)

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|cpaA]
  description: [Pubmed|22383849]

Biological materials

Mutant

• MGNA-B163 (yjbQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1162 NBRP B. subtilis, Japan]
• GP2082 (''[gene|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|cpaA]''::''ermC''), available in [SW|Jörg Stülke]'s lab
• BKE11640 ([gene|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|cpaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCAGAACCTCCTTTT, downstream forward: _UP4_TAAATCTTGACCAAATAAGG
• BKK11640 ([gene|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|cpaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCAGAACCTCCTTTT, downstream forward: _UP4_TAAATCTTGACCAAATAAGG

Expression vectors

• pGP2909 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

FLAG-tag construct

• GP2438 ''yjbQ-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab

References

• 26171638,23995679